Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11034D11
Clone ID IST11034D11
Vector VICTR76
Project tigm

Sequence tag IST11034D11HMF1
Sequence
TGCATGAATGATGCGCCTGTTGTTTTCTTCCTCTGTGCTGTAGATAACGCTTCTCAGGCCTGGAATATTGAAATAGAGGC
TTCTTTTGATGTCGCCAGCTCGAAGTCCGTTAGTGGTCAGGTGACAGTAGCCATCCCTCAACTGAAAACACAGCAGACAA
ACGACATTGAACTTCAACAAGAGCAAAGGATTGTTAAACTACTGGTCAAAATTAGGAAGGTGAGTGACCTCACTTCCTGG
GAGGTGCTAGATGCATGCATTTGCTGTTCAAGGGAAGAAATGGCGGAGTGGGAGTGCCTAGCAACTTTCTCCCTGTATTT
TCCAAAAGTCGTTTTCTCACTATTTTTTATTTTTAAGAGTTTCATTTAGATNATTTTTTAAAGACAAGANTGCACACTGT
NNNACAAAATTAAGCTCACAATGCAGCCCANGGTGGCTTCTTTTTGTTTGTTTGTTTGTTTGTTTGATATAGGGTCTNAC
ATTGNNNCCCANGCTGGA
Sequence Type genomic DNA
Unitrap ID UNI11183

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135185913..135186409 475
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028164 (Manba) NM_027288 mannosidase, beta A, lysosomal Gene [Source:MGI (curated);Acc:Manba-001]

 
Come back to gene ENSMUSG00000028164


For any suggestions or comments, please send an email to unitrap@crg.es