Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14135F10
Clone ID IST14135F10
Vector VICTR74
Project tigm

Sequence tag IST14135F10HMF1
Sequence
TCCCATTCTTACTGAAGAACTATTGGTAGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14135F10BBF1
Sequence
ATCCCATTCTTACTGAAGAACTATTGGTAGTTGACAGCTGCTANAGTAAGGAAAATTACATTTAAAATTTGAGTGCTGTG
GCTACTGGAACAATTTCCACACTCCAGTGGATGGTCCAACACCCATGCACAGAAAGGTAGCCCCAACTAGATGGGGTGTG
TGTGTGCATGCATGAAATTAGGGGACTGTACTGAGAGGAATATGGGGGTGTTGGAGGGAGGTTNANNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 97003839..97004061 221
NO GENE  


Sequence tag IST14135F10HMR1
Sequence
GGATCTGGACACTGTTGCATATGCCANAAAGATTTTGCTGAAGAAGACCCTGTTATAGCTGTCTCGTATGAGGCTTTGCC
AGTGCCTGGCAAACACAGAAGTGGATGTTCACAGTCATCTACTGGATGGAACACAGGGCCCCCAATGGAGGAGCTAGAGA
AAGCACCCAAGGAGTTGAAGGGGTCTGANCCCTATAGGTGGAACAACAATATGAACTAACCAGTACCCCCAGAGCTCGAG
TCTCTANCTGCATATGTAGCAGAAGATGGCCTANTTGGCCNNTN
Sequence Type genomic DNA
Unitrap ID UNI10738

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 97003563..97003842 272
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032449 (Slc25a36) NM_138756 solute carrier family 25, member 36 Gene [Source:MGI (curated);Acc:Slc25a36-001]

 
Come back to gene ENSMUSG00000032449


For any suggestions or comments, please send an email to unitrap@crg.es