Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12776D1
Clone ID IST12776D1
Vector VICTR76
Project tigm

Sequence tag IST12776D1BBF1
Sequence
ATATAAGTACACTGTAGCTGTTTTCAGACACACCAGAAGAGGGCATCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI33861 UNI33862

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 56486202..56486254 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95418466..95418518 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046519 (Golph3l) NM_146133 golgi phosphoprotein 3-like Gene [Source:MGI Symbol;Acc:MGI:1917129]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 26676505..26676557 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031565 (Fgfr1) NM_001079909 fibroblast growth factor receptor 1 Gene [Source:MGI (curated);Acc:Fgfr1-001]


Sequence tag IST12776D1HMF1
Sequence
ATATAAGTACACTGTAGCTGTTTTCAGACACACCAGAAGAGGGCATCAGATCTTATTACAGATGGTTGTGAGCCACCATG
TGGTTGCTGGGATTTGAACTCATGGCATCTGGAANAGGAGTCAGTGCTCTTAACTGCTGAGCCATCTCTCCAGCCCGGTT
CCTTTTCTTTTTGAGACAGGCTCTCCTGTCTATAGCCCAGAATGCACTGTGTANATGAAGCTAACATACAAGCTTATCAG
ATTTTATGTGCCTATGTACACATTTTCTTTGTTTANACAGTCTTCTGGCATTTTTATATACATTATTATTGTTATNAGTA
TTATTATTTTGGGGGGGGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 56486202..56486540 331
 
EST/CDNA Est Name
  BE370688.1 - BU937147.1 - CA465326.1 - BU961809.1 - BU939375.1 - BY090670.1 - BU939701.1 - BU936923.1 - BY082193.1 - BY091040.1 - BF021874.1

 
Come back to gene BE370688.1 - BU937147.1 - CA465326.1 - BU961809.1 - BU939375.1 - BY090670.1 - BU939701.1 - BU936923.1 - BY082193.1 - BY091040.1 - BF021874.1


For any suggestions or comments, please send an email to unitrap@crg.es