Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10979D1
Clone ID IST10979D1
Vector VICTR76
Project tigm

Sequence tag IST10979D1HMR1
Sequence
CTTNANTGTCNTAGCAGTGAACATATTTTCAGTAGCGGGTAACATCCGCGGAAGACTGGATACTAGCGGTGAACTTGACT
GCCGCTGGGTAATGGCTAGGAGAACTGTGAGGCCAGCAACTGGGAGTAGTGATTGTAGGAACCACCACAGGGCACCTCCA
TAGCAGCCATTCTTGTAGTTTCTCGCCATGCATCCATCATGTGTGTTCATTTNNNNAGCAGCCNTGANAGAGATGTGTGT
Sequence Type genomic DNA
Unitrap ID UNI24470

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 100133241..100133480 222
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041632 (Mrps27) NM_173757 mitochondrial ribosomal protein S27 Gene [Source:MGI Symbol;Acc:MGI:1919064]


Sequence tag IST10979D1HMF1
Sequence
NAAGGATATATTAACTTTAAAAACACAGAATAATATGATCCGAGGAAAATAAATAAATCAGTGATTACTAACTTGAGTCT
GGTATATTTATTTCCTTACATTTCAGCCACCACAGCACAAAATATCTACTGGTAATTATAAAAACATACTACACTGTGGA
AAGTTATTCCCATGTGACTACTGTTTCTACAGCCCAGCCCAGCCTACAGTCTTGATTGCTTCCTTCTTTGAAAGTAGGTT
GGAAATGTTCTTACCCGTGATATTGATAAAGAACTAACAGGCAATTTTCTTTCATACGCTTTGTCCATTAAGGATGCAAG
ATCAGCTGTGAAGACAGAAGACAAAGAACCCTGTTAAATATACACATTTCTCCAGGAAAATCTAACAGCTCTGACTCCTA
CCAGATGGCCGAGAACGTCACANAGTCNGCGTCTAAACAGGTGCTCACTCTTGCTCTTTTTAAAAATTGAGGACAACTNT
TGAGTCAGTTTNNAATNATTTGATGANCTNNNGAATACAAGCACTTGGGAGGN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 100132713..100133243 511
 
EST/CDNA Est Name
  BQ622901.1

 
Come back to gene BQ622901.1


For any suggestions or comments, please send an email to unitrap@crg.es