Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14980D7
Clone ID IST14980D7
Vector VICTR76
Project tigm

Sequence tag IST14980D7BBF1
Sequence
CTCCTGTCTTCTGTTTTTCATAACCCACGCACACAA
Sequence Type genomic DNA
Unitrap ID UNI14655

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 95942666..95942700 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 42497419..42497453 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032017 (Grik4) NM_175481 glutamate receptor, ionotropic, kainate 4 Gene [Source:MGI (curated);Acc:Grik4-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 63320563..63320597 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 38514826..38514860 33
NO GENE  


Sequence tag IST14980D7HMF2
Sequence
GGTGCCTATTACGGTCATCATATCCAGTTTCTGTTCTAATAAGGAAGTTGATAGCATTCACAAGAGTGAAGGGAGGGAAC
TGGGATAAATCCAAGAAAATGGAAGGCGGGCTTACCATAGCCCACACGTGGTCATGTGTGTGTGTGTGTGTGTGTGTGTG
TGTGTGTGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 65252392..65252559 168
NO GENE  

 
Come back to gene ENSMUSG00000032017


For any suggestions or comments, please send an email to unitrap@crg.es