Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15108H9
Clone ID IST15108H9
Vector VICTR80
Project tigm

Sequence tag IST15108H9BBF1
Sequence
TATGTAGGAAGGTAGGTAGCCTCAGCTGGCCTCGAACTCCCAGAGATATGCCTGCTTATGCCTCTCAAGTGCTGCTGGGG
TTAAAGGTGTGTGCAACAACTCCCAGTTAGAATTTGTTGTTGTCGTTAAAAGAAAAACAGACAAACAACACTTTATGGAC
ATAATTAACATGATGTAAAAGTGATGTTTCAATACATTCACAAAGCAATGCAGTCATCCCTTTTAACCCGAGGCCAGTTT
GGGTTTTTAACCGGAGGTTGCTGAGGACGATCCATCCTTCCTGAGAAGCAGAACCTGACTGTGGCAGATCCGCTGAGTCA
CAGCGTCGGTGTCCGANCTGAACCCGGGTCTGGCGTCTGGCGCCCCCTAGCGAGGCCTGAGTGGCAGAAAACCCCACTCG
GCGCTGCCCGGANCACCGCGGGCCCCCCCACCCNNNNNCTCGCACCNAGGAAGCTGCTGGGTCCNNNTCTCACAGGCNTC
TGAATCACAN
Sequence Type genomic DNA
Unitrap ID UNI30181

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104139391..104139878 461
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018411 (Mapt) NM_001038609 microtubule-associated protein tau Gene [Source:MGI (curated);Acc:Mapt-003]


Sequence tag IST15108H9HMR1
Sequence
CATATATACNTANAAACATATGTGTTTCAACAAACAACCCCATCGCCCCNNAGAAACCCACTAAATCTANAATAGATAGC
AGGCANATTTGGTGAAAAGCAAGTANAGATAGAGTTTCCAAATTACCTCCCAATGGACATTGCTCTCAAGGGTTAGTTTT
GACCACACCACTAGCAAGGCCAACTGGGACAACACAGAAAGACCTGGGTTCAAAAAAATATCAAGGGCTGAGCTGGGCTG
TGGTGGCACACACGTTTTANTCCCAGCACTTGGGAGGCANAGCCAGGTGGGTCTCTTGAGTTTGAGGCCANCCAGGTCTA
CAGAGAGTTTCAGGACAATCAGGGCTTTACACAGAGAAACCTTGTCTGGAAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104139015..104139394 360
 
EST/CDNA Est Name
  BI202659.1


Sequence tag IST15108H9HMF1
Sequence
TATGTAGGAAGGTAGGTAGCCTCAGCTGGCCTCGAACTCCCAGAGATATGCCTGCTTATGCCTCTCAAGTGCTGCTGGGG
TTAAAGGTGTGTGCAACAACTCCCAGTTAGAATTTGTTGTTGTCGTTAAAAGAAAAACAGACAAACAACACTTTATGGAC
ATAATTAACATGATGTAAAAGTGATGTTTCAATACATTCACAAAGCAATGCAGTCATCCCTTTTAACCCGAGGCCAGTTT
GGGTTTTTAACCGGAGGTTGCTGAGGACGATCCATCCTTCCTGAGAAGCAGAACCTGACTGTGGCAGATCCGCTGAGTCA
CAGCGTCGGTGTCCGAGCTGAACCCGGGTCTGGCGTCTGGCGCCCCCTNNCNAGGCCTGANTGGCANAAAACCNNANTCG
GCGCTGCCCGGANCNCCGNGNGCNCN
Sequence Type genomic DNA
Unitrap ID UNI30181

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104139391..104139813 399
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018411 (Mapt) NM_001038609 microtubule-associated protein tau Gene [Source:MGI (curated);Acc:Mapt-003]

 
Come back to gene ENSMUSG00000018411


For any suggestions or comments, please send an email to unitrap@crg.es