Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13045B12
Clone ID IST13045B12
Vector VICTR76
Project tigm

Sequence tag IST13045B12BBF1
Sequence
TTAGGACCNNGNNCNGNCNAGGTCNANCNANNGNNNNANNNNNNNNANTTTANAAAAACANTGTNNTAATTTCAAAAGTA
CAGCCAAATTCCTTTACTTTGATCCAAGCTTTGATTGTCACTAAAATCAAGTGACAAAATAAGCTAAATTTGGGAACGGG
CCTTTGAGCANATGCATCGCAAAACAGTTAANCAAGATGCCGAAAAACAATGACTCTCGCTTCCCTTTGGGATCACTGGT
AAANATATGANATTATACATTTGATCACTGGCTGCTTCTTTTTTTTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 103795292..103795529 220
 
EST/CDNA Est Name
  BY123064.1 - BY124081.1 - BY293167.1 - BY128106.1 - BY317832.1 - BY127453.1 - BY126612.1 - BY125280.1 - BY098240.1 - BY109168.1 - CJ087929.1 - BY778167.1 - BY125406.1 - BY048316.1 - BY127208.1 - BY128893.1 - BY294269.1 - BY326858.1 - BY278333.1 - BY129364


Sequence tag IST13045B12HMR1
Sequence
NTNNNCTTNAAATTAATTAAAATGCATTACACTTTCCGTGGTGCTAATACATGTGTTCANAAAAACCCCTGGAAGCCTTC
ACTCGGATAACATGAAGCTTAAACTATTCTGTTTCTAACTTTAAAAACACACACACACNCNCNCNCACACACACACACAC
ACACACNCN
Sequence Type genomic DNA
Unitrap ID UNI32838

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 103795052..103795212 149
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034187 (Nsf) NM_008740 N-ethylmaleimide sensitive fusion protein Gene [Source:MGI (curated);Acc:Nsf-001]


Sequence tag IST13045B12HMF1
Sequence
CTAGCNNCGTTTCAGTAAAACATTTCCATAAATGGTGATTAGTTTGATTAAAAAAAAACAATGTCNTAATTTCAAAAGTA
CAGCCAAATTCCTTTACTTTGATCCAAGCTTTGATTGTCACTAAAATCAAGTGACAAAATAAGCTAAATTTGGGAACGGG
CCTTTGAGCANATGCATCGCAAAACAGTTAANCAANATGCCNAAAAACAATGACTCTCGCTTCNCTTTGGGATCNCTGGT
AAANANATNANATTATACATTTGATNNCTGGCTGCNTCTTTTTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000034187


For any suggestions or comments, please send an email to unitrap@crg.es