Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14420F2
Clone ID IST14420F2
Vector VICTR74
Project tigm

Sequence tag IST14420F2HMF1
Sequence
GGAGGTCCTCTGTGGCTGGGTGACTATCCATGCAGGCTGGGATAGAGGCACAGAAGGCATCCCTACTGGCGTGTGCTGGA
GAAGCTGAGTAGTACTGGTCACATACGTGCAGGGACTTAGGGGCGGGCAGGGGCCTTCAGAAGGTACAGAAGAGCTCAAA
GGCACCAGGAAAGCTGCACTACCTGAGCAGAGGCAGGAGGGCAGGGATAGAGTGGGGACACTTGAAATGGAAGAACAGGA
TGCTATGTTC
Sequence Type genomic DNA
Unitrap ID UNI15384

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 10307670..10307918 249
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036098 (Gm98) gene model 98, (NCBI) Gene [Source:MGI Symbol;Acc:MGI:2684944]


Sequence tag IST14420F2BBF1
Sequence
GGAGGTCCTCTGTGGCTGGGTGACTATCCATGCAGGCTGGGATAGAGGCACANAAGGCATCCCTACTGGCGTGTGCTGGA
GAAGCTGANTAGTACTGGTCACATACGTGCAGGGACTTANGGGCGGGCAGGGGCCTTCAGAAGGTACAGAAGAGCTCAAA
GGCACCAGGAAAGCTGCACTACCTGAGCAGAGGCAGGAGGGCAGGGATAGAGTGGGGACACTTGAAATGGAAGAACAGGA
TGCTATGTTGACCGAGGGATAGCTTTCTGAGGCGCTACCATTGTACACTCCGTGGAGAAAGATGCTGAGGGTCTGCAAGG
TCAAGGAGTCACTCTGCAATTAAGCAGANGCCCATGTTGGCNNCCAGGCCTCTCANANGATCACACGGATGCNNAGGTGA
C
Sequence Type genomic DNA
Unitrap ID UNI15384

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 10307518..10307918 381
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036098 (Gm98) gene model 98, (NCBI) Gene [Source:MGI Symbol;Acc:MGI:2684944]

 
Come back to gene ENSMUSG00000036098


For any suggestions or comments, please send an email to unitrap@crg.es