Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13270C5
Clone ID IST13270C5
Vector VICTR74
Project tigm

Sequence tag IST13270C5BBF1
Sequence
NAGCCCTCCTTTGGAATAACTGTCTACTCGGGGAGCCTGAGTAAGCACGAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI31160

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28590342..28590395 54
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074243 (AC164532.4-202)  


Sequence tag IST13270C5HMF1
Sequence
GAGCCCTCCTTTGGAATAACTGTCTACTCGGGGAGCCTGAGTAAGCACGAGATCTCAGACTATATCCGAGAGCATCCTCA
GTGAGCACTTTCCTTCACTTCCCTCAACACTCACAATGGCTACAGCTCTGAGAAAATCGTGGAACTCAGCAAGTAGCTGC
CCTCCCAGGCGACCCTCGGAGGCACTTCCAGCCTCAAATGCTCGTCTCAAGCTCCTCTGAACCTCTGGCANACTCCGCAC
CTGACCTCTCCTTACTGAAGTTTGGTCCTCTGTGTANTCCCAGTGGCCAG
Sequence Type genomic DNA
Unitrap ID UNI31160

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28590108..28590396 285
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074243 (AC164532.4-202)  

 
Come back to gene ENSMUSG00000074243


For any suggestions or comments, please send an email to unitrap@crg.es