Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14159C3
Clone ID IST14159C3
Vector VICTR74
Project tigm

Sequence tag IST14159C3HMR1
Sequence
NGGGAAAAAAGAGGGAGCCGGAGAGGTGAACTGTAATGGCGAGCAGTGGGGAAGAACGTGGCN
Sequence Type genomic DNA
Unitrap ID UNI12168

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55704437..55704497 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040721 (Zfhx2) NM_001039198 zinc finger homeobox 2 Gene [Source:MGI Symbol;Acc:MGI:2686934]


Sequence tag IST14159C3BBF1
Sequence
CCTGCTTTCCTCTGGACTCCTCTCTCCTGGTCCCCATTGTTCACCCCTCTTCTCTCTCCTCTTCTGTCTCCTTGCCTCCA
CCTCTGGGCTGCCTTCCATTCATCCTCCTCCACATGGTGTCTGTCCTCCCCTTGAGTTTTGTTTCCTTCTCTCTGTCTTC
TTTGGCACCCTTCCCCTGCCCTTCACCTCTGCTGTCCTTCCCCTCCCCCACACTGCCCTGTCTGGCCAGAGGACAGATCT
G
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55704496..55704735 240
NO GENE  


Sequence tag IST14159C3HMF1
Sequence
CCTGCTTTCCTCTGGACTCCTCTCTCCTGGTCCCCATTGTTCACCCCTCTTCTCTCTCCTCTTCTGTCTCCTTGCCTCCA
CCTCTGGGCTGCCTTCCATTCATCCTCCTCCACATGGTGTCTGTCCTCCCCTTGAGTTTTGTTTCCTTCTCTCTGTCTTC
TTTGGCACCCTTCCCCTGCCCTTCACCTCTGCTGTCCTTCCCCTCCCCCACACTGCCCTGTCTGGCCAGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55704496..55704724 229
NO GENE  

 
Come back to gene ENSMUSG00000040721


For any suggestions or comments, please send an email to unitrap@crg.es