Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15078G12
Clone ID IST15078G12
Vector VICTR80
Project tigm

Sequence tag IST15078G12HMR1
Sequence
TGGGTAGCTTTACTAGTCNAGTGTTTATTCNAGATTTCTACTTATTTGTTTTATTGACGTTCTTACCTTTGGACATCTCT
GATCAGATATGTGAATTACAGCTAGGAGTATGCCTCAGTGACATAACACTTTCCTGATGTGCTCTGGCTTCTGTTCCAGG
CACCACAGGAAAGAGGCCTGTCTGTCTGTCTGTCTGTCTGTCTCTCTCTCTCTGTCTCTCTCTCTCTCTGTGTGTTGCAT
TGAGGGAAATGAAAGAGTGTTGGCTAACACAGCACATGGCATGTATANAATCTTTTCAAGACATCGTGTGATTTAATATT
CAGGCATTCNAGATTCCTCTAAGTGTCTACTAAATGTCTGATACTT
Sequence Type genomic DNA
Unitrap ID UNI23144

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135220935..135221300 358
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028164 (Manba) NM_027288 mannosidase, beta A, lysosomal Gene [Source:MGI (curated);Acc:Manba-001]


Sequence tag IST15078G12HMF1
Sequence
CCCACATGGTTACTATGCTCTGCAGGGCAGTGGTGCCACACACCTTTAATCCTGGCACTTGGGAGGCAGAGGCAGGAGCA
TCTCAAGGCCAGCCTTGCCTAAAGAGTGAATTCTAGGGAAGCCAAAGATATACAGAAAAACCCATCTGGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135220788..135220938 151
NO GENE  


Sequence tag IST15078G12BBF1
Sequence
CCCACATGGTTACTATGCTCTGCAGGGCAGTGGTGCCACACACCTTTAATCCTGGCACTTGGGAGGCAGAGGCAGGAGCA
TCTCAAGGCCAGCCTTGCCTAAAGAGTGAATTCTAGGGAAGCCAAAGATATACAGAAAAACCCATCTGGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135220788..135220938 151
NO GENE  

 
Come back to gene ENSMUSG00000028164


For any suggestions or comments, please send an email to unitrap@crg.es