Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14312C6
Clone ID IST14312C6
Vector VICTR74
Project tigm

Sequence tag IST14312C6HMF2
Sequence
AAGATGGGGCGTCCCANAATTGAGTAGCCCCCTAACAGTCACCTGGCCTAGGCGAGCAGTATTTTAACACGCCCCCTCCC
CAGTCCGTCCTCAGCCCTGCGCCAGTGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 33286241..33286351 109
NO GENE  


Sequence tag IST14312C6BBF1
Sequence
GTACCNCGTGTGTTTGCTGTGTTTGTGGAGCCCAGAGGAGGGTGTCAGGTTTCCCTGGCACTGGAGTTACAGCACTTTGT
GAGCTACCATATACGCTCTGGGATCAAACACAGGACCCCTGCAAGAGCAAGTGTCCTCAACCTGCTGAGTCACCTCCCGA
CCCCTAAAATGATAATTAAAAAAAAATACATTTATCNATTTATTTTGGTGTTCTGAA
Sequence Type genomic DNA
Unitrap ID UNI30528

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79459392..79459607 212
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017639 (Rab11fip4) NM_175543 RAB11 family interacting protein 4 (class II) Gene [Source:MGI (curated);Acc:Rab11fip4-001]

 
Come back to gene ENSMUSG00000017639


For any suggestions or comments, please send an email to unitrap@crg.es