Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14793G3
Clone ID IST14793G3
Vector VICTR76
Project tigm

Sequence tag IST14793G3HMF1
Sequence
AGATAACTAAGACGACCCTAGGTATCTGGGTAAAAAACTTAACAATCAATCATTCTCTCTCCAGAAATCAATTCCCTTTA
TCTTGGCTGCTTAAGAGTCATAATCACAGGTGGGAGAAGTCAGCTCAAGTGGTGGATGAGAAAACAGCGGGGTCCTGAGC
AGAGCCCTTCCCCGGGGAGCCAAGAGAAGCTCTTGGACTGAAGAAAGGCAGGAGGCTCTCATGGGCCCTGAATAAGGCTA
CTCACTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 36059706..36059953 248
 
EST/CDNA Est Name
  BY444918.1


Sequence tag IST14793G3HMR1
Sequence
ATCTTAGGAAGCTACAGCTGCTCACCTCATCAAATTACCAGCAGCTAACTGGGGACAGGACCTTCTTAGAAGTATGAAGA
AGTGAGCANCTTGCATGGGTCTTCATTANCCCCACTCTTAAGTTGTCAAGGCTATTTTGTGAGCACAGATCTGATGTTTC
TTACCTAGAAAATAGTACACATGAACACACATGANTCACTGAGTCTTAAATGTGCTGATGNNATTTATTAGAGGGGTAAG
TTANTGGGGGCCTTTCCTTGCCATCCATTTATCCTGGTTTGTTTTGTTGTTCTTTTACCTCANAAGCCACCATCATGGGT
TCAGGTCCCATANNCCCCAAAGAACTGCTCANGGGCCTGGATANCTTCCTTACCCGGGACGGANAANTGAANAGTGTGGA
TGGAATTTCCNNNANCNTCN
Sequence Type genomic DNA
Unitrap ID UNI15043

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 36059950..36060359 382
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039220 (Ppp1r10) NP_787948 protein phosphatase 1, regulatory subunit 10 Gene [Source:MGI (curated);Acc:Ppp1r10-001]


Sequence tag IST14793G3BBF1
Sequence
AGATAACTAAGACGACCCTAGGTATCTGGGTAAAAAACTTAACAATCAATCATTCTCTCTCCAGAAATCAATTCCCTTTA
TCTTGGCTGCTTAAGAGTCATAATCACAGGTGGGAGAAGTCAGCTCAAGTGGTGGATGAGAAAACAGCGGGGTCCTGAGC
AGAGCCCTTCCCCGGGGAGCCAAGAGAAGCTCTTGGACTGAAGAAAGGCAGGAGGCTCTCATGGGCCCTGAATAAGGCTA
CTCACTGGCCAAACACCAAACAAGTGTTTATTGTTCCAAAGTTCAAGAGAAACTTGGCTTGTGGTTTCAGAAGCNAAGAT
GCAAACCTGACCCTTTCCTGCCCTCAAGACTCACCACTCTCNNANACTCCCAANACAAGCCCCAANTTGAGAACCAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 36059558..36059953 384
 
EST/CDNA Est Name
  BY444918.1 - BF143046.1 - CN698402.1

 
Come back to gene BY444918.1 - BF143046.1 - CN698402.1


For any suggestions or comments, please send an email to unitrap@crg.es