Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_227B3-3
Clone ID CMHD-GT_227B3-3
Vector pGTNMDi
Project cmhd

Sequence tag CMHD-GT_227B3-3
Sequence
CCTGTCCTCGCCGAGAAGAGTACTCCATAGTCCACAGGAAGTGCCGTTCTCAATTCACAGACCTCAATGGCTCCAAAAGA
CTTGGCATCAACACATGGCACGATGAGAGTGGAATTTATGCTAATTCAGAGGCAAAACAAAAACTCTACGCATTGGCTAG
AAATCCTATTGTCCCATTTTAAAAAGCAATGTATACAACCAGACCCTCATGCTAATGAAAAACGACAAATGTAGTAGTTA
ATAATTTTCATAATAAAAACAAAGCCTTCCAAATCT
Sequence Type mRNA
Unitrap ID UNI13854

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 23633250..23633526 273
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033053 (1700028P14Rik) NM_026188 RIKEN cDNA 1700028P14 gene Gene [Source:MGI Symbol;Acc:MGI:1914733]

 
Come back to gene ENSMUSG00000033053


For any suggestions or comments, please send an email to unitrap@crg.es