Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14725C9
Clone ID IST14725C9
Vector VICTR76
Project tigm

Sequence tag IST14725C9HMR1
Sequence
NNGACACACAAGGAGTGAGACCGGTATTGCAAGCCCACACTGTGTCTAGGGGAGGCACCAGATACTGACCGCTTTTGCTA
GACTGGATGTTCTGGGTCTGATTACAGAGGTGCCCTTTATCCTGAGGTACCCGGCCCANACAAAGCCCTCTTCCTGAAAC
TGCTGCTANNNTCC
Sequence Type genomic DNA
Unitrap ID UNI21618

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 75171644..75171809 164
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018809 (Smyd4) NP_001096081 SET and MYND domain containing 4 Gene [Source:MGI (curated);Acc:Smyd4-001]


Sequence tag IST14725C9HMF1
Sequence
TTNTGTCTGTTTTTAATAGTTCCAAAGATTTCTGCATTTTGGTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 20901040..20901083 42
NO GENE  

 
Come back to gene ENSMUSG00000018809


For any suggestions or comments, please send an email to unitrap@crg.es