Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12747G11
Clone ID IST12747G11
Vector VICTR76
Project tigm

Sequence tag IST12747G11HMF1
Sequence
AGGTGTGTTGGGGTCCCCTGGACTGGGCGAAGTGGGTGTGCTGGGTTCTGGTGATGGTGAGTGGTCTTGGTTCCTGTTAG
TAAGATTCCTCCGTTTACCTTTCGCCATCTGGTAATCTCTGGAGTTAGTAGTTATAGTTA
Sequence Type genomic DNA
Unitrap ID UNI28018 UNI33670 UNI33671

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 16286633..16286771 139
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 14003781..14003919 139
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 59208421..59208559 139
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055254 (Ntrk2) NM_008745 neurotrophic tyrosine kinase, receptor, type 2 Gene [Source:MGI Symbol;Acc:MGI:97384]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 16370602..16370740 139
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 65890171..65890309 139
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 35443102..35443240 139
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022844 (Pdia5) NM_028295 protein disulfide isomerase associated 5 Gene [Source:MGI Symbol;Acc:MGI:1919849]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 59275866..59276004 139
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 35979993..35980131 139
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055453 (A830019P07Rik) RIKEN cDNA A830019P07 gene Gene [Source:MGI Symbol;Acc:MGI:3028035]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 46983936..46984074 139
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 52240167..52240305 139
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 71740536..71740674 139
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 64049326..64049464 139
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 127650866..127651004 139
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 78938454..78938592 139
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 69930115..69930253 139
NO GENE  

 
Come back to gene ENSMUSG00000055453


For any suggestions or comments, please send an email to unitrap@crg.es