Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11689D11
Clone ID IST11689D11
Vector VICTR76
Project tigm

Sequence tag IST11689D11HMF1
Sequence
GGCACCAGCCACCTTCGCGCTCGCCGGCCCCTCCGCGGCCGCGAGGGAGGCGCACCGGCGGCGAAAAGGCGCGCGTCCTC
TCTCGACTCCTCGCTTCCTATTGCGTCGGGGCCTCTCGAATTCGGCTAGTTATTGTGTCTCTGGCTCGGCGCCCGAGTTC
GTGTCTCGGGCTGCTCTCCCCGCCCCGGACTGCGTTCCATTCTTCTCCGCCCGAGCACGCTGAGCGCGCCAGCCTCGGCC
ACAGCCAAGCCCCGAGGCCACCGTGCGTTTCCCGCGAGGTGCGAGGACCCCGAATCGGTGTGGGGAGGCGGTGAGGTCAC
GCTCGGGGGGGGATCACACACGCACTTAGGAATCCCAAGGGATTCANCTGGAGTGAGCGAACCTCACTCGGACGCGTGGA
Sequence Type genomic DNA
Unitrap ID UNI31296

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97561453..97561851 397
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018537 (Pcgf2) NM_009545 polycomb group ring finger 2 Gene [Source:MGI (curated);Acc:Pcgf2-001]

 
Come back to gene ENSMUSG00000018537


For any suggestions or comments, please send an email to unitrap@crg.es