Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11605C8
Clone ID IST11605C8
Vector VICTR76
Project tigm

Sequence tag IST11605C8BBF1
Sequence
ANCCTANTNCTTGGGAGGCAAAGGCAGGAGGGTCANAACAAACAGCTAGATTCTGCCNCATGANACCCTGTCTNAACAAA
TNANTAAAAAATAAAAAAGAAGAAGAAAGTTCTTCTTGGGGGCAAGTCCCACTACCTNTTNAAAAACACCATTAAGAAAA
TGGAGGAATGAGGATGNNNCTGATACTTTGATTAAAAGCAAGCCCTATCTTTANATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11605C8HMR1
Sequence
AAATACACTACCAAAGGGAATTTCTTAAAGTAGAATGTTC
Sequence Type genomic DNA
Unitrap ID UNI33878

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 28210337..28210375 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021895 (Arhgef3) NM_027871 Rho guanine nucleotide exchange factor (GEF) 3 Gene [Source:MGI Symbol;Acc:MGI:1918954]

 
Come back to gene ENSMUSG00000021895


For any suggestions or comments, please send an email to unitrap@crg.es