Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13020G4
Clone ID IST13020G4
Vector VICTR76
Project tigm

Sequence tag IST13020G4HMR1
Sequence
TAGCCNGGCCTTTCTGTTCTTAATGTGAACTTCTTTTGCTGTCTTATGTGGTCTGAATCTAAAATGTGTATGTATTCTAA
ATTTATGTCTGCCTGATTGTGCCTTTTGCTTTTAGTTCGCTTATTCTTTTACTTCATATCTTTATTTAATAATTAATTAA
TTATCTATTTAATATTTTTAAAAATTTTAAAAAGATTTATTTATTATTATATCTAAGTACACTGTAGTTGTCTTCANATG
CACCANAAGAGGGCGTCNNATCTCATTACAGATGGTTGTGAGCCACCATGTGGTTGTGGGATTTGAACTCNNGACCTTTG
GAAGAGCAGTTGGTGCTCTTANCCNNNGNNCCNTNTNTN
Sequence Type genomic DNA
Unitrap ID UNI23433

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 9139709..9140052 328
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042508 (Dmtf1) NM_011806 cyclin D binding myb-like transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:1344415]


Sequence tag IST13020G4BBF1
Sequence
CTACTAGCCNATGTCACAACACATGAGAAAACCTATCTAGTTCTACAAGCACCAAATGGAATAGCACAACTGTAATCACT
GCTATTAACAGCTCAAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 9140050..9140150 99
NO GENE  

 
Come back to gene ENSMUSG00000042508


For any suggestions or comments, please send an email to unitrap@crg.es