Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12129E9
Clone ID IST12129E9
Vector VICTR76
Project tigm

Sequence tag IST12129E9HMR1
Sequence
AAAAGAAATACAGCTTTTACTTACTTCTTTGTAAAGCTCTCTTGGAAAGAGGAATAATGGTGTTTCTGGTTTTTGTTTGT
TAGTATGTAAGGAAGTAAGAGTTAAGTTGCTCAGAGACTATATAATATGACACTGTGGCACTTTTAGGCCGTTTTAGATT
GTTCTGTGATTTGAGCTATGCCATCTAACTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI26780

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 107701636..107701835 200
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031885 (Cbfb) NM_022309 core binding factor beta Gene [Source:MGI Symbol;Acc:MGI:99851]

 
Come back to gene ENSMUSG00000031885


For any suggestions or comments, please send an email to unitrap@crg.es