Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10902H4
Clone ID IST10902H4
Vector VICTR76
Project tigm

Sequence tag IST10902H4HMF1
Sequence
CCATCTCTGCCTCCCGAGTGCTGAGATTAAAGGCGTGCACCACCACACCCGGCTAT

Sequence Type genomic DNA
Unitrap ID UNI31127

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 48662540..48662589 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 23714826..23714875 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062012 (Zfp13) NM_011747 zinc finger protein 13 Gene [Source:MGI Symbol;Acc:MGI:99159]

 
Come back to gene ENSMUSG00000062012


For any suggestions or comments, please send an email to unitrap@crg.es