Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12054B2
Clone ID IST12054B2
Vector VICTR76
Project tigm

Sequence tag IST12054B2HMF2
Sequence
CCTTTCTCTGAGGAACATGGAGCATCCAACCCTAAGATGATTTCCCCTTAAGCATCTGATTCAGTAACTATTTAAACCAG
CTAATATAATACTAAGTTTCAAACTCAGGACAAGCAGTTGAGGTGCCTATTAAACATATCAAAGCAGACCTGACCTCCAG
GTTCTCCCAGCATCCTTCACTTTCTAGCTCAGGGGCAGGGCTGCCCTTACCCAGAGGCTCTTCCCAATATAGTCCAGACA
TTTTCGTTACCTCCTCTCTCTGCCCTTTTTCGACTTCCTGGCTGCTATAGTGGTTCCCCTCTCTCCCTTCTTCTCCTCCT
CCACTCTCTGTCCCTACATAGTTCAGGGTCATGACCACTCTAGTCTCTCCCAGANGTCCCTGCCTCTGGCTATGCTCTCC
TACATATCTATGACACACTTTCTCCTCCNCCATACCTAGGAGCAGTCNTGGCCTTCCCATTCCTTTTTCTTTTCTTTTTN
ATTCANTTNACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 57106219..57106709 479
NO GENE  


Sequence tag IST12054B2BBF1
Sequence
AGAGAAGAGCTGGATTATATGCCCCATTCATTCCTTATGTGATTTTTGACACCCTTCCTGCCCTCAGACAGTAAGATGAC
TAATCTAGCTGATTTTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI1957

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 15126482..15126588 107
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079709 (AC182749.2-203) NP_001116842 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q8C5D3]

 
Come back to gene ENSMUSG00000079709


For any suggestions or comments, please send an email to unitrap@crg.es