Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12838E8
Clone ID IST12838E8
Vector VICTR76
Project tigm

Sequence tag IST12838E8HMR1
Sequence
CATCTTCNCAGGAAGGAGGAGTGCCTTCCTGCCTTGGGCCTTGTTCTCCTCAGACTCGAGTGCTACCCGAGTGAAAGCAG
ACAGGAGGCC
Sequence Type genomic DNA
Unitrap ID UNI13150

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27936862..27936951 88
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056692 (D17Wsu92e) NM_001044719 Uncharacterized protein C6orf106 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q3TT38]


Sequence tag IST12838E8HMF1
Sequence
GATGGAAGTGCTCCGGAAGCAGGGGTCCCCAGAAGGACCCTGTAATCTGCCTCAGTCAGTCCAGGTTCAAGCTGCTAAGT
ATTAAGATGAATTTGCAGATGGAAGCCACATTGTTACAGGAACTTATTGCAATGCAAACCTCTGAGGCGAAGTCTGAGGG
CGGTGCTGTGTATGTGCACTGCACTGTGTACTCAGGAGGACAAAGGCAGACTGTGCATGTAACCTGAGGCTGCACTCTGC
TGAGTCACTTCCGTCACACACCTCGGGGTCCAACAACTCACGTTTCGGTCAAAAGAGCAGGTTTAGAATAACTCCTTGTT
TTGGTCGCTGGATTTAATTTCCTGAAATGATTTACAATCGCTGTATCTATGGTAACTACAGTTTCTGGAAATTCTGANCC
ACTGTGANGAGACAATGTGGATTGCCCCAAACACCACAGGATGACCGCACAAAGCATGTCCAGACACAGCGCTCCTTACA
CACGNNTCTGGTTTGNCATGAAACTCNGANAGTGAGTTANGGTATNAGCANANAAATCTGCAACTAAGCNGAANTTNAAA
CTGATTTNANCCTAAGACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27936948..27937525 546
 
EST/CDNA Est Name
  AA015310.1 - BF123948.1 - BI158729.1 - BY755073.1 - CX220817.1 - BY732481.1 - CX238259.1 - BF141975.1 - CJ182828.1 - BB621281.1 - BY733987.1 - AI843814.1 - BU963008.1 - CJ048410.1 - BE854231.1 - BE980680.1 - AW824413.1 - BG230287.1 - BE979906.1 - BE688798

 
Come back to gene AA015310.1 - BF123948.1 - BI158729.1 - BY755073.1 - CX220817.1 - BY732481.1 - CX238259.1 - BF141975.1 - CJ182828.1 - BB621281.1 - BY733987.1 - AI843814.1 - BU963008.1 - CJ048410.1 - BE854231.1 - BE980680.1 - AW824413.1 - BG230287.1 - BE979906.1 - BE688798


For any suggestions or comments, please send an email to unitrap@crg.es