Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14752A8
Clone ID IST14752A8
Vector VICTR76
Project tigm

Sequence tag IST14752A8BBF1
Sequence
TCATGAGCCAGATAGAGCTATAAAAAAATGAAAAGGAGATTCTTCAGTTCTATGTTTTAGAAGTAGTATGTGTGTGCAAT
CACTTTGGGCTGGTTTTTTTTTTTTTTTTTTTTTTTTTNNNNTTTTTTTTTTNTN
Sequence Type genomic DNA
Unitrap ID UNI7447

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 23599438..23599569 124
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020280 (Pus10) NM_001033654 pseudouridylate synthase 10 Gene [Source:MGI (curated);Acc:Pus10-004]


Sequence tag IST14752A8HMF1
Sequence
TCNNNGANCCANNATAGANCNNNNAAAAAATGAAAAGGAGATTCTTCANTTCTATGTTTTANAANTANTATGTGTGTGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14752A8HMR1
Sequence
ATGATATATTTATATGCTCAGGAGTTAATGTAGTATTTCTGCCTGCAACTCTCTGAAATACAACAAAAACAAAGACAAAC
TTACCCAAATGAAATAATAGGTATACAATAAAATATATGATAAAATAAATATAGTAAAATTGCACTAATTATAGAATCTA
ATATGGGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 23599273..23599441 169
NO GENE  

 
Come back to gene ENSMUSG00000020280


For any suggestions or comments, please send an email to unitrap@crg.es