Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13088A9
Clone ID IST13088A9
Vector VICTR76
Project tigm

Sequence tag IST13088A9HMF1
Sequence
GGACTNGACCCCCACCTGAGATGGTGGATCTCTGTGCCTGCTGAACTTTCTACATTTCATTTCTCCAAGTCCAGGGCTTT
TAATCTGGATCCATCCCTGCCTGGGATGGGTAGGTGCCAACCTGGANATCCCTGTGGGCAAGTCTTATCACCCATATCCT
GGGGAGCTGCAAAGCTCTGGTTGCCGTGGAAATGAGAGGGTGGGTGGTTTGAGGTGGGGCCTGGCTGGTGGCTCNNNTAA
GGCTGGGGCGGCCNGCTGAAGGTGGGTGCGGCTGANNTGGAAGGATGGGAAGCCTGCTGGCTATTGACCTGANCCTGGGA
GGTTGAAGGGGGTCTTCCGACACCTGGACTGGCTTCCNCTATGGTGCCGTACCCCCACCCCTCCCCTTCTTTCCCNTNCC
CTTCCTGCTGNAGCCTGACCTTTTANTCCNTATCCACANAAGTTACAGAACTTGGGGGAGTGTTNNGAATGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13088A9BBF1
Sequence
GGACTAGACCCCCACCTGAGNTGGTGGATCTCTGTGCCTGCTGAACTTTCTACATTTCATTTCTCCAAGTCCAGGGCTTT
TAATCTGGATCT
Sequence Type genomic DNA
Unitrap ID UNI11419

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 71023982..71024072 89
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022099 (Epb4.9) NM_013514 erythrocyte protein band 4.9 Gene [Source:MGI Symbol;Acc:MGI:99670]

 
Come back to gene ENSMUSG00000022099


For any suggestions or comments, please send an email to unitrap@crg.es