Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13663C1
Clone ID IST13663C1
Vector VICTR74
Project tigm

Sequence tag IST13663C1HMR1
Sequence
GCNCCANCCAGGGCCCAGGGGTACCAGGGATACGGTTTTCCAGGTCTTCTGTGGGGTGCTCCACTGCGCGAACCACGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7252120..7252197 74
NO GENE  


Sequence tag IST13663C1BBF1
Sequence
GTGCCCAGCGAGGACCGGCTCTCGCGGGCTCTAGGGGTTCGGGGTGGGGGCGCGCAGCTTGCTCTGGANATGGCAGCCGG
AAGGCGGAGGCATTGAGCACCAATAGACAGCTTTGTGCTCACTAGGTGAGGTCCCATAAGGTTCTAGCATGCAGGACCGC
CAGGCTCTAANCTTTTCCCTTANAGCTTTAACCTGGTTTAGTACCTTCCCACTGCACATTGCACAGTGGAGTGGTCCCCA
CCCCTTCAANACNCCAGTGGTATGGCCCTCCCANAGCCCAGAGCGCTCGCACCCNACCACCCNNANNTCCGCGTGCGCGC
NNNTTN
Sequence Type genomic DNA
Unitrap ID UNI29306

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7251804..7252123 298
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031147 (Magix) NM_018832 MAGI family member, X-linked Gene [Source:MGI (curated);Acc:Magix-001]

 
Come back to gene ENSMUSG00000031147


For any suggestions or comments, please send an email to unitrap@crg.es