Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11001E10
Clone ID IST11001E10
Vector VICTR76
Project tigm

Sequence tag IST11001E10HMF1
Sequence
CTGGGAAACCCATCCCAACCTTCCTGCCTTTTCTGATCCCATGTGCTTACCCTCTTGATAGGGCTCCTTGTGTACGGGCT
GAGCCTATTGTGCTTTTCTGCGCTTCGGCCCTTCGGCGAGCCGAGGCGGGAAGTGGAGATCCACCGGCAGTACGTGGCCC
AGTCTGTGCAGCTCTTCATCCTCTACTTCTTTAACCTGGCTGTGCTTTCCACCTATCTGCCCCAGGACACCCTCAAGCTG
CTCCCGCTGCTCACCGGTCTCTTTGCCATATCTNGGTGAGTCGGGCGGGGGCTGGGGTGGA
Sequence Type genomic DNA
Unitrap ID UNI14067

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88136337..88136636 298
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001420 (Tmem79) NM_024246 transmembrane protein 79 Gene [Source:MGI (curated);Acc:Tmem79-001]

 
Come back to gene ENSMUSG00000001420


For any suggestions or comments, please send an email to unitrap@crg.es