Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11779B7
Clone ID IST11779B7
Vector VICTR76
Project tigm

Sequence tag IST11779B7BBF1
Sequence
AAGGGAACCCAGGGAAGAAAAAGGATTTAGAATCGCCATGCTGATCAAGCTTGAGAGCTGCGGGAGAGGAAGCATACAGC
CATGGAAGAGTGAGAGCTGTGGGACAGGAAGCATACAGCCATGGAAGAGTTGGGGAAGAGCAGCCCCAGCGGTGCCTCCC
CCACTGGGTCTGGGGTAACAAAGATGGAGTATAGATTTTAGTAAGTAATCATTCATGAGTATCANAGGGGAGGAGTTAGT
AACATGAAAATTAGGGAGTGGCCCAACCACTGATTTACGTAGAGCATATTAAAAATAAGGCTGTGTGTGTTTGTCTTTCA
TTAAAAAATCCAGAGCATCTTGTCAGGTGGCAAGCATTGAGCACCAATTTGAGTAGTGTTCACAATTAATACAGCAGATG
GTGTCCAACCTGTANGCTCGCACTCNCTAAAAAAACTAATTGGAGATGCTCAANGGGAGAACACACACCATGGCATGANA
NTNNGANGTGGAAGAATTGGCTTCTTANCNCANCTGCTGGTTCNNCCCCNNGCCCNNAATTGGGTTTGGNAN
Sequence Type genomic DNA
Unitrap ID UNI33149

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 173876320..173876868 513
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015314 (Slamf6) NM_030710 SLAM family member 6 Gene [Source:MGI Symbol;Acc:MGI:1353620]

 
Come back to gene ENSMUSG00000015314


For any suggestions or comments, please send an email to unitrap@crg.es