Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10524C12
Clone ID IST10524C12
Vector VICTR76
Project tigm

Sequence tag IST10524C12HMF1
Sequence
GTCCTTTCATCCCAGCTCACTTCACTCTGAGCCAGGCCATTTCCCAGGTCACCCAGTAACTGCGGAGCTTTTGAATTGTG
CTCATTGATGTTGTANACAAGTCACAGTGTCTAAGTATGGGCTTGGGGCAGAGAGTGTAGCACAGTGGA
Sequence Type genomic DNA
Unitrap ID UNI31102

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 118994145..118994292 146
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000010660 (Plcd1) NM_019676 phospholipase C, delta 1 Gene [Source:MGI Symbol;Acc:MGI:97614]

 
Come back to gene ENSMUSG00000010660


For any suggestions or comments, please send an email to unitrap@crg.es