Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14854A4
Clone ID IST14854A4
Vector VICTR76
Project tigm

Sequence tag IST14854A4HMF1
Sequence
CTAGTATACACAGAGACTTCCAAGNTAGCCAGCGTTATATGGTGAGGCCCCGTAGCAAATATGTTCATGTAACTCTGCTT
CATAAATCAGCTAGTGCTGAGTTCTTTTCAGCGTCAGGGCCATCAACTGAGCTCAGCTAGTGCTGAGTTCTTTTCAGCGT
CAGGGCCATCAACTGAGCTCAAGTCCTTAAAAGGCTAGGGCAACTCCCCACGCTGCAGAGTGGAGCTGTGTCTCTGTCTT
GTAACCGCGGACACTCAAGAATATTGATTCTGGCGGTCCTCTTACCTTCTCTCTGCAGGAAGACCGTTGCTTCGGGTCTT
CCGAANGGGTTTCTTCACGACAGGGCAATCTGCTTTANACTGCGAGTCTCTGGGGTCTGTCTGTTCNGGGACCTGTGCTT
CTGGAGTCANTNNNGNCNCCTCTCTTTAANANTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 124614429..124614862 410
NO GENE  


Sequence tag IST14854A4HMR1
Sequence
GAAGGAGGAGTGCCTTCCTGCCTTGGGCCTTGTTCTCCTCANACTCGAGTGCTACCCGAGTGAAAGCANACAGGAGGCC
Sequence Type genomic DNA
Unitrap ID UNI13150

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27936862..27936940 75
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056692 (D17Wsu92e) NM_001044719 Uncharacterized protein C6orf106 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q3TT38]


Sequence tag IST14854A4BBF1
Sequence
CTAGTATACACAGAGACTTCCAAGATAGCCAGCGTTATATGGTGAGGCCCCGTAGCAAATATGTTCATGTAACTCTGCTT
CATAAATCAGCTAGTGCTGAGTTCTTTTCAGCGTCAGGGCCATCAACTGAGCTCAGCTAGTGCTGAGTTCTTTTCAGCGT
CAGGGCCATCAACTGAGCTCAAGTCCTTAAAAGGCTAGGGCAACTCCCCACGCTGCAGAGTGGAGCTGTGTCTCTGTCTT
GTAACCGCGGACACTCAAGAATATTGATTCTGGCGGTCCTCTTACCTTCTCTCTGCAGGAANACCGTTGCTTCNGGTCTT
CCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 124614541..124614862 318
NO GENE  

 
Come back to gene ENSMUSG00000056692


For any suggestions or comments, please send an email to unitrap@crg.es