Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15002C1
Clone ID IST15002C1
Vector VICTR78
Project tigm

Sequence tag IST15002C1BBF1
Sequence
ACTTCAACTTCACAGCTTCTTGTTCCAATGTCTGGGATTCATACATGATCTTTGTAGCATGCTAGGTAGGCTATGGCTGA
CTTCACTCCACAGCTGCTGCTGTTCTTGGTGATCATGGTGATGGTACTGGTATCTCCAATACACAAGTGTCTTCCGTTGC
AACTAGGCTTCATCAATAGGTTCTCTTCACAATACCAAGCCTCAACTCTTTTGCATGGTCCTTTCANTCCTGGGTCTTCA
AATGTCACTANNGCNGTACCTTCAACNATGGCCTCTCCNNNCCTCTCACANTGCCTAACCNNANCTGCTCTCCATNACCC
NTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15002C1HMR1
Sequence
AAGTTACATTGGAGACCCCAAGATGTTCGAGATGCCAAAGCCATAGGATATCTGCTGAGAAAAACTGTTC
Sequence Type genomic DNA
Unitrap ID UNI14993

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108507222..108507290 69
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029267 (Mtf2) NM_013827 metal response element binding transcription factor 2 Gene [Source:MGI (curated);Acc:Mtf2-001]


Sequence tag IST15002C1HMF1
Sequence
ACTTCAACTTCACAGCTTCTTGTTCCAATGTCTGGGATTCATACATGATCTTTGTAGCATGCTAGGTAGGCTATGGCTGA
CTTCACTCCACAGCTGCTGCTGTTCTTGGTGATCATGGTGATGGTACTGGTATCTCCAATACACAAGTGTCTTCCGTTGC
AACTAGGCTTCATCAATAGGTTCTCTTCACAATACCAAGCCTCAACTCTTTTGCATGGTCCTTTCAGTCCTGGGTCTTCA
AATGTCACTAANGCTGTACCTTCNACGATGGCCTCTCCTANCCTCTCACAGTGCCTAACCTCNNCTGCTCTCCATGACCC
N
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108506906..108507225 310
NO GENE  

 
Come back to gene ENSMUSG00000029267


For any suggestions or comments, please send an email to unitrap@crg.es