Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10919F3
Clone ID IST10919F3
Vector VICTR76
Project tigm

Sequence tag IST10919F3HMR1
Sequence
CCTTTGACTCCAGTAGTTGGAAGGCAGAGACAGATGGATATCTGTGAGTTCAAGGCCCCTCTGGTTTACATAGTGAGTTC
TAGGACAGCTAGAGCTACATAGTGAGAACTTGTCTTGAAAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI2177

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 119016483..119016610 128
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034278 (Dnajc17) NM_139139 DnaJ (Hsp40) homolog, subfamily C, member 17 Gene [Source:MGI (curated);Acc:Dnajc17-001]

 
Come back to gene ENSMUSG00000034278


For any suggestions or comments, please send an email to unitrap@crg.es