Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12576A11
Clone ID IST12576A11
Vector VICTR76
Project tigm

Sequence tag IST12576A11BBF1
Sequence
CTAGAACTTTCTTTTNAACCCCCGACTGAACCCACCACTCATTTCCTGCATCGGATCTCCCTTCGCACCCACCCACTTTG
TCCATTCTGGCCACCACTCGGACCTTGACCCCCATGTCTGGCCTTCAAGGCTCCCAACTCAGGCACCAGGTCCGTACCTC
TTCCATGTCCCGGCGCTGGAAGTTTCTCCGGCCCCGACTCTAGGCTGTGCTCCTTAACTANATCTG
Sequence Type genomic DNA
Unitrap ID UNI30796

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 151919704..151919928 221
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060257 (Scrt2) scratch homolog 2, zinc finger protein (Drosophila) Gene [Source:MGI (curated);Acc:Scrt2-001]


Sequence tag IST12576A11HMF1
Sequence
CTAGAACTTTCTTTTCNACCCCCGACTGAACCCACCACTCATTTCCTGCATCGGATCTCCCTTCGCACCCACCCACTTTG
TCCATTCTGGA
Sequence Type genomic DNA
Unitrap ID UNI30796

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 151919704..151919793 88
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060257 (Scrt2) scratch homolog 2, zinc finger protein (Drosophila) Gene [Source:MGI (curated);Acc:Scrt2-001]

 
Come back to gene ENSMUSG00000060257


For any suggestions or comments, please send an email to unitrap@crg.es