Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10888A11
Clone ID IST10888A11
Vector VICTR76
Project tigm

Sequence tag IST10888A11BBF1
Sequence
NAGGAACAAAGTCTCANTCCCTCCAGACTTTCCACACATCAAGGATGGGGCCTACAGCACCCTGTGCCACCCTCCTGCTG
CTCTCAGCATTCCTGGCTCTGATCCNNACCAAGAACCAGAGCTTTGCTGGTTATGGTTAGTGTGGGTCTGGAGGGAAACA
GCTCCGGACAACACTCGGGAAGCTGCTCCTTCTCATCGCCCANCAACACTCTCCANTTCCCTTTTCTATCCTATGTTCGG
AGTCCGGTGCCCTGAACCCCTCTTGACCCNANGAACCACCAGANATCCCCAGGATGAGGTCGGGGTCTCACCGCGCTNTG
TCTGCAGGTTNACATTCCTTGCGGTATTTGGTAACCACGACCGTGTCTGGACCAGGTCTTCGAGATTCCCATGTCTTNNT
TNGTTGGCTNCNTGAACTACATGCAGTTNATGCGCTTTGACAGTGATGGAACTACTCAGANGATCT

Sequence Type genomic DNA
Unitrap ID UNI14476

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 37107922..37108384 428
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000083534 (CR956641.9)  


Sequence tag IST10888A11HMR1
Sequence
NGACTGTGAATAGTTCTCTAAAATTCCTACATGCACTGGGAGTGAGAACATGGGTCCAGATGGAAGAACAGCGCAACTGA
CACAGTTTGTAAGCTACCCAGAGAGAATTCAGAAGGGACAAGGGACTTCCCAACCCATGGCTTCCCCACCACAGACACCT
TGAAGACAAAAACCTCACACTGGGGACTTAGGAAAGCCCACTTCCTCCTGTACTTGGTGCTCTTTGACACATCTGCTCTC
TCTGAGTCCTGTTAAGGACCTTTGTCCTATGANATTCTCAGTGTTANAATTCNNGATCTCTTGTTTGTGCTTACNCNNTN
NNCACCTCATTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 37108430..37108764 315
 
EST/CDNA Est Name
  EH096046.1


Sequence tag IST10888A11HMF1
Sequence
NAGGAACAAAGTCTCAGTCCCTCNNNANTTTCCACACATCAAGGATGGGGCCTACAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene EH096046.1


For any suggestions or comments, please send an email to unitrap@crg.es