Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14949F11
Clone ID IST14949F11
Vector VICTR76
Project tigm

Sequence tag IST14949F11HMR1
Sequence
AGANCTTACTACTGATGGTTGTGAGCCACCATGTGGTTGCTGGGATTTGAACTCAGGACCTA
Sequence Type genomic DNA
Unitrap ID UNI22153

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 96481185..96481246 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038354 (Ankrd35) NM_001081139 ankyrin repeat domain 35 Gene [Source:MGI (curated);Acc:Ankrd35-001]


Sequence tag IST14949F11BBF1
Sequence
TTACAATCTGCTTCCTACCTACAAGTTATAGATGTTAAGTAATAGCTTTGGGTTTTGAGAAACTAAGCTCTGCTGGGCAA
TAAAGAATTGTTGGGCCCCAGCCTGACCATTCAGTATGCCTGGTATCAAAAGCAAACTGCCTGACTTCAAACCACAAAGC
AGCGCTGTACCTTCCCAATGGTACAACATGTAGTGTAGGTGCACACACAAGTCCCCAGCCCCTCTAAATGCCCACAGCCT
TCATCCCACAGGAAAACGTGGGGCCCTCAATGCTCTACTGAAGCAGTCTAAGCCTGTTGAGAGTCTGTCTGCCTGTCTGC
CAGTCTCCTTTTTANTTTATATTTTTTAAGACATATTTATTTATTGTATATAAGTACACTGTANCTGTTTTCANNCACCC
CAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 74717387..74717787 393
 
EST/CDNA Est Name
  CA465413.1 - BU936523.1 - BU961422.1 - CN841687.1 - BU937836.1 - AA063862.1

 
Come back to gene CA465413.1 - BU936523.1 - BU961422.1 - CN841687.1 - BU937836.1 - AA063862.1


For any suggestions or comments, please send an email to unitrap@crg.es