Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14709C7
Clone ID IST14709C7
Vector VICTR76
Project tigm

Sequence tag IST14709C7HMR1
Sequence
TAAGAACCTTATGCTGGTCTAAACATGTTAATAAAGTACGGTGGATGAAATGATGTGTTATTTCTAGTTTGAATCTTGAG
ATTGAAAGCCCCCCATCAGTGTAAAACAATACAAGGCCATGTCTTACTGATTTAACTTANCTAAAGTGCTTTGCAGTATC
TTGGTGGCCCATTGAAGGTANTAAATGAGTTTTGGGTTTCCCTGTGTGATTCACGTTCAGTTTTGTTAAATAAGACCCAT
GCTTATTGGAGCACTTCAGTAATCCTGACTTCCTGGGACTGTATGTTCTCNCCACTTTAATAANTTTATAGTCTGGGGAA
NTANGGCATCTTTATCTGCACAAAAACACTGTGTATCNNTTGGATTGAATCGTGGGAGTNNATGGCAAACTTCCCAAATT
ANCACTGANAGTTCTAN
Sequence Type genomic DNA
Unitrap ID UNI2398

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 21976851..21977266 392
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027630 (AC121108.12) NM_030732 F-box-like/WD repeat-containing protein TBL1XR1 (Transducin beta-like 1X-related protein 1)(Nuclear receptor corepressor/HDAC3 complex subunit TBLR1)(TBL1-related protein 1) [Source:UniProtKB/Swiss-Prot;Acc:Q8BHJ5]


Sequence tag IST14709C7HMF1
Sequence
CTGTAAATGGCATATAACCCTTCACCCTGGGGCCGATAAAGTCCAACCAAGGTTTTAAGAAAACTCCAGACTGTTAAAGA
AATGTAATGTTTAGCTATGTTCCAACTCTTCTGTGTGATCACCAAATTATTTTCAGTGTTGGGTAACCTAACAAAGAGAG
CGTTTCTTAAAAGCCACCCAACCCAAATGTTACACAGAACAGACCATTTTCACAACCTAAATTTAATCCAAATTGAGAAC
TTCCAAAATTACCGAACACTCTAACACATGCATGATTCGCCTCGAGCTGCCTTTCAACGTGGAATTACACTTAAATGAAA
GTCAGCCCCTGTTCCNAAAAAAAAAAAAAAAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 21976449..21976808 358
 
EST/CDNA Est Name
  CF969351.1 - CK381125.1 - CK381391.1 - CF351645.1 - CF621155.1 - CF620588.1

 
Come back to gene CF969351.1 - CK381125.1 - CK381391.1 - CF351645.1 - CF621155.1 - CF620588.1


For any suggestions or comments, please send an email to unitrap@crg.es