Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14286B6
Clone ID IST14286B6
Vector VICTR74
Project tigm

Sequence tag IST14286B6HMF1
Sequence
AGACCNACTTAATCATCAAAGCAGTGAGCTATTCAGAAGGACTAACCTAGCCTAGATGCTTAAACCTGTGATTCTGTGTG
CCCGTGCTAAGAGATTTCTAAAGAAGAAATAAACTTCAAATTCCTAAGTTCAGTAGAGGGAAGGAGCTGATGCTGAAATC
ATGGACACACTCAGTGAATATATATACTCAGTAGTATACATGTACACTAATGTACATATTATATATACATTTACAAGCTA
TGCTGTATNNNANGCAAATATGCTGCTTACAAACAGGCTTTTCTTTTTCTGTTCAGCAGGAGGCATTAGTTGGANAGGCA
GGGGGTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 121257917..121258244 316
 
EST/CDNA Est Name
  BB861417.1


Sequence tag IST14286B6HMR1
Sequence
NTCTCTTGCTGCTCCTGATTTCAGGGTGACTTATTTTAATTTTGAGATCATATGAAACATGAATATGATCTAAAGTCCAG
AGTANTAAAAGAGGTGACCCCATACCCTGTTCATCCCTCCACTCTAACTCCGCCCAGTTGTCAGTTCTCTGTTGCATATG
TGTTGCATTGCTGATTACGTCATCCTTACATGTTAGCATCATTGCTTATGCGTTATCTTCATTGCTTCCGTGCCANCATT
GCTGCTTATGTGTTAGCACTGTTGTTTACGTGTCANCATTGTTGTTACATGTTGGCATCATTGCTTACATCATTGCTTAT
GTGTCAGCATTGCTGCTTACATTGTTGCNACGTGTTANCATCGCTCTTTGCTTATTANCATCATTGCTGCTTATGTGTTA
NTGTTTTN
Sequence Type genomic DNA
Unitrap ID UNI14300

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 121258242..121258647 392
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032536 (Trak1) NM_175114 trafficking protein, kinesin binding 1 Gene [Source:MGI Symbol;Acc:MGI:1914345]


Sequence tag IST14286B6BBF1
Sequence
AGACCAACTTAATCATCAAAGCAGTGAGCTATTCAGAAGGACTAACCTAGCCTAGATGCTTAAACCTGTGATTCTGTGTG
CCCGTGCTAAGAGATTTCTAAAGAAGAAATAAACTTCAAATTCCTAAGTTCAGTAGAGGGAAGGAGCTGATGCTGAAATC
ATGGACACACTCAGTGAATATATATACTCAGTAGTATACATGTACACTAATGTACATATTATATATACATTTACAAGCTA
TGCTGTATACAATGCAAATATGCTGCTTACAAACAGGCTTTTCTTTTTCTGTTCAGCAGGAGGCATTAGTTGGAGAGGCA
GGGGGTGTGTTTTGGGCGGNAGTNNNCANNNCCTTNNNCTGTNAATGCAAANNNTCCCNCANACNNNGANNNGNCNNGCN
GGGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000032536


For any suggestions or comments, please send an email to unitrap@crg.es