Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13115A12
Clone ID IST13115A12
Vector VICTR76
Project tigm

Sequence tag IST13115A12HMF1
Sequence
AACCTTTTGTGCTGCAGAGGTGGTGGCGGGGATGGGTGGGGTACGCGCGTGAGTGTGGGTGCCCCAGTCAGCGAGA
Sequence Type genomic DNA
Unitrap ID UNI33891

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 99558301..99558375 75
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044768 (D1Ertd622e) NM_133825 Uncharacterized protein C5orf30 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q8VEB3]

 
Come back to gene ENSMUSG00000044768


For any suggestions or comments, please send an email to unitrap@crg.es