Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_214G4-3
Clone ID CMHD-GT_214G4-3
Vector pGTIV1(-)
Project cmhd

Sequence tag CMHD-GT_214G4-3
Sequence
GCTGTGTAATGGACCAGGAACATGCGNTCCCTATCTGTGTGTCCGCCCTGCTTCTTGGGATACTTGGAGTGAAGAAAGTG
ATCATCGTCTATGTCGAGAGCATCTGCCGAGTGGAGACGCTATCCCTGTCAGGGAAGATCCTGAGGCACCTCTCCGACTA
CTTCATTGTTCAGTGCCCCACTCTCAGGGAGAAGTACCCCAAGTCTGTGT
Sequence Type mRNA
Unitrap ID UNI13874

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 121064476..121064684 202
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039887 (AC105336.14) NM_024178 UDP-N-acetylglucosamine transferase subunit ALG14 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q9D081]

 
Come back to gene ENSMUSG00000039887


For any suggestions or comments, please send an email to unitrap@crg.es