Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15088G10
Clone ID IST15088G10
Vector VICTR80
Project tigm

Sequence tag IST15088G10HMR1
Sequence
NTNNNNNNNNNGNNNNNNTNNGNNNNTGCNNNGNNNNTCANNTTNTNNNTTTNTTTNANGTGGGTACATGCTANGCAAGT
ACTCCACCACCGANCCACACCCANCCCCCTCTTAANTTTTGTTTATTTTGAANACAAGAGTCTTACTGTGTANTTCAGAT
GGTTTGATCAGGCTGGCTTTGAACCCACTCAGATCCATTAAGACCCTTGCCTGCCTGCCCTTCTTTCTACATAGGGGTCC
TCCGCACTTTTGGTTCCTTTTTTCTTTTTTTCTCTTTTGGTTTTTCGAGACAGGGTTTCTCTGTGTAGCCCTGGCTGTCC
TGGAACTCACCT
Sequence Type genomic DNA
Unitrap ID UNI24859

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 57149764..57150046 265
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002658 (Gtf2f1) NM_133801 general transcription factor IIF, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:1923848]


Sequence tag IST15088G10BBF1
Sequence
TATACCACCTGTGACCAGTTTGGGGTTTTCTTTTATTTTGGGACAGGACCCGACTATGTAGCCCTGGCTGTCCTGGAACT
CACTATA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 57150092..57150178 87
NO GENE  

 
Come back to gene ENSMUSG00000002658


For any suggestions or comments, please send an email to unitrap@crg.es