Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14944H9
Clone ID IST14944H9
Vector VICTR76
Project tigm

Sequence tag IST14944H9HMR1
Sequence
ATGGTTAGGGTTNAATACGACATGAGGGTCATAGCATTAGAAAGGCTGGGAACCACAAAAAAAGCTTTAGGGATAGACGA
GAAGGCTCANTATTATAAAGTGTTATAATTTTTTATATTAAAGTATTTATATATCAGTATTATACTGATGGGCTTCTGAC
TTCANATTCCTACACTAAGGGGAAAAGTTAGTCATGGCCGCGCTTGCCTGTAATCACAGCACTGGAAGAAAGGCAGGAAG
ATCCTAACACTAACCTAATTGGACTAAGAGTAATTTAAAACAGCCACAGTGCTGGGCTAGGGGTGGAACTTGCCTGCCAA
TCNNGAAACCCTGGGATANCNNNNNNNNNNNNNNNNNNNNNNNNCNNTNNNGCCAANTGCCNATAACCTTANCGCTNNNN
ANGTGGAGTCCGGGTGN
Sequence Type genomic DNA
Unitrap ID UNI16756

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22397843..22398258 328
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013089 (Etv5) NM_023794 ets variant gene 5 Gene [Source:MGI Symbol;Acc:MGI:1096867]


Sequence tag IST14944H9HMF1
Sequence
CCATAACATTATTTCACTGCTACTTCATAACTGCAATCTTGCTACCGTTACAAGTCCTGGTGTAAATATATCCGCCGTGC
AGGATATCTGCTATGGGGCACCCTTTGGGGTCACGACCCACATATTAAGAACCTCTGCCTTTTGTATACATTCATTAAAC
ATCAAGACATTAATTAATGCTCGTGGGCAGATCACCTTGTATTTTTCCTCATAGCTGTTCTTAGTTTCTCCGATTANAAA
ACGCTGTCTGTCACTGTCACACCCTGTACTGTTTTGTGAGCGGCTCACCTCTGCATTGCTTTACCGGCCTTCCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22398255..22398568 310
 
EST/CDNA Est Name
  BF320950.1 - CF162212.1 - CN686320.1

 
Come back to gene BF320950.1 - CF162212.1 - CN686320.1


For any suggestions or comments, please send an email to unitrap@crg.es