Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15008G1
Clone ID IST15008G1
Vector VICTR78
Project tigm

Sequence tag IST15008G1HMF1
Sequence
CATTGTTATTACACCAGAGTGAAGGCTCTACACAAACCTAGTTTTAAATGTAACAATGGAAAGTGGCNAGTANNANTTGC
NTGGCTAATGGGAATTTCCCTACCAAATAAAAAAAAATTAAAAAAAATTAANCCCTGCTGGAGGGAATGTCTATANACAA
ACAGAAAATAATTTCNAATAATTTCTTACATTTTCNTAAGGAAATGTGGACACCTAACCTTACATAAATGTTAAAAATGT
GCATTATATTGTAATCANAAACNNNGTTGGCTCTCAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15008G1HMR1
Sequence
CCTTGTCCNCACTCTGCTCATCAGACTGGAGCAATCAAGCCCTGTGGGTNNNNGNNGGAGCTCGCTCTCCCTCGCCGTCC
CTCTCACAGTGCTGGGAACCAGGTAGCAGCCTTTGTGGATTCCAGGCAAAAGTTGCTCTGTGGAGGACTGGCCTGAGCTT
CTGACCCGTCTTTCCCAGGTGATCGTGGAAAAAGTCTCGGGCTCTCANATTGTTC
Sequence Type genomic DNA
Unitrap ID UNI19271

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114466224..114466437 198
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031950 (Gabarapl2) NM_026693 gamma-aminobutyric acid (GABA-A) receptor-associated protein-like 2 Gene [Source:MGI (curated);Acc:Gabarapl2-001]


Sequence tag IST15008G1BBF1
Sequence
CATTGTTATTACACCAGAGTGAAGGCTCTACACAAACCTAGTTTTAAATGTAACAATGGAAAGTGGCAAGTATCAATTGC
TTGGCTAATGGGAATTTCCCTACCAAATAAAAAAAAATTAAAAAAAATTAANCCCTGCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 22756188..22756326 137
NO GENE  

 
Come back to gene ENSMUSG00000031950


For any suggestions or comments, please send an email to unitrap@crg.es