Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_213B4-3
Clone ID CMHD-GT_213B4-3
Vector pGTIV1
Project cmhd

Sequence tag CMHD-GT_213B4-3
Sequence
TGAAGCGATACCTGATCTACTTTACTTTGAAACTCGATAACAGGCCCTGAAGCACTGAAGAAAGGAGTTTCTCCAGGAAA
AGGCTACGTTCTTCAGAATTCAGCAGAAGGATGAGCAGCCTAAGATTCCAGCTGCAGGGGGTGAAGTGCCAGAGGTGTCT
TGACCAAAGGACCAGGCAAAGTGTGACAATGGCACACACTTTGCCTCTACATGCTATCTCGGATCTTTGAAA
Sequence Type mRNA
Unitrap ID UNI13881

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 45327888..45328110 200
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035601 (Rg9mtd3) NM_027266 RNA (guanine-9-) methyltransferase domain containing 3 Gene [Source:MGI (curated);Acc:Rg9mtd3-001]

 
Come back to gene ENSMUSG00000035601


For any suggestions or comments, please send an email to unitrap@crg.es