Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_213A3-3
Clone ID CMHD-GT_213A3-3
Vector pGTIV1
Project cmhd

Sequence tag CMHD-GT_213A3-3
Sequence
AGGAGATGGCTGCAGAGGCGGAGGCTCTGCGGGTCTACTTTCAGGCCTGAGAGTAACTCAAACGATTCCCAAGGCATAAG
AAAATGAACCCCATTCTTCTGGAGTCTTCGACA
Sequence Type mRNA
Unitrap ID UNI13884

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 10382844..10405970 71
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060579 (Fhit) NP_034340 fragile histidine triad gene Gene [Source:MGI Symbol;Acc:MGI:1277947]

 
Come back to gene ENSMUSG00000060579


For any suggestions or comments, please send an email to unitrap@crg.es