Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10043H8
Clone ID IST10043H8
Vector VICTR75
Project tigm

Sequence tag IST10043H8BBR1
Sequence
GTACCACTGAGCCTGTCTAATATTTTGCTTTTTACCATAATATATGAATTTATTTCTTTTCCAAGTGCCAACACTGACCT
TGGCCTCAAAATCTGTGATTTCTCAATAGCTCCTCATGAACTTGCACAGTAACATTCACACACACACACACACACACACA
CACACACACACACACACT
Sequence Type genomic DNA
Unitrap ID UNI26728

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 80228679..80228855 177
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061589 (Dot1l) NM_199322 DOT1-like, histone H3 methyltransferase (S. cerevisiae) Gene [Source:MGI (curated);Acc:Dot1l-001]

 
Come back to gene ENSMUSG00000061589


For any suggestions or comments, please send an email to unitrap@crg.es