Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14553H1
Clone ID IST14553H1
Vector VICTR74
Project tigm

Sequence tag IST14553H1BBF1
Sequence
CNAAATAATATTTTAAGGCATAAAAACTAANANNNTATCATCTATTAATACTTTCTTAGAAACCAGCCAACCAACCAACC
GAAGGGGCTGGAGAGATGGCTTTTTCCTTAAAGAGCATTGACTAGCCTTTCGGNNNNTGTCTGCACCCGGAGCTGATCCT
GTGTCACAGTGCTCCATACCCAAATACCTCTGGGAGAGAGCTTGTCTCCCAGGAGTGCTGGCACACCTGTGAATACCTGT
AAGACCACTACTTCTGCCCAAATTCCTAGCCCAAGAGGGACCAGCCTATAGTAATCAGGACACAGGAACAAAGGACAGCC
AGGGACAGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 35670968..35671297 314
NO GENE  


Sequence tag IST14553H1HMR1
Sequence
GTAATTACTAATTGTATTTTAATTTATCNGATACCAATTTATTGAGGATACAGTACTACATTCTGTTGCTTTTTGGCATT
TTTTAATTGGTGTAAAGTATGCTTTTTTTTTTTTTTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI12465

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 35671299..35671426 122
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037400 (Atp11b) NM_029570 ATPase, class VI, type 11B Gene [Source:MGI (curated);Acc:Atp11b-001]

 
Come back to gene ENSMUSG00000037400


For any suggestions or comments, please send an email to unitrap@crg.es