Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14471G2
Clone ID IST14471G2
Vector VICTR74
Project tigm

Sequence tag IST14471G2HMR1
Sequence
ATATTCTTCATTACTTGGAGTCTTCATTAAGGTCACCCTATAGCATCCAGGAAGTTGATATTGTACTGGGTTTTTACACT
AACCCCCAAATGACCCCATTCCAGCTGTTTCTCCCTGCATTGTACTTTAACCCTGCATTAACCCAACTGATCCCCACCAC
TCCTGTTCCAATCAAACCTCANTCTACTCACAGAAACTACTCTATTTCCCCTTTAGAAGGAGATCTGTGCTTCCCTCCTA
TANCCCATCTCTACCTANCCTCTCTGGGTTTGTGGAGTACAGCTTGATTATTGTTTACCTAATAGGAAATATCCNCTTAT
AANTGAATGCNTGCTGTGTTTGTCTTTCTC
Sequence Type genomic DNA
Unitrap ID UNI4672

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 98295189..98295537 337
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074887 (A630089N07Rik) RIKEN cDNA A630089N07 gene Gene [Source:MGI Symbol;Acc:MGI:2444323]


Sequence tag IST14471G2BBF1
Sequence
ATATGAAGTCTGAACTGAACATCCTTTTGAGGCCNGCCAGGGCTTCAGTATTAGAAATGGGCTACATATATAGTTGAGCT
GTTGGCTAAGGTGGTCCCTTGGAGATCCTTAAACAATCCATGCTGATGCTGGGACAAAACTGCTCTCACATAACTGACAG
CAGGGCCCCATCAATCAGGACAAATTCTACAAGGTTCACTGAATGTAGAAACCAAACTGGTGCAGGCTTGGAGCTTTCAC
CCCTATGTTCTATTCTCTTTGAAGAGAGAAGGAATTCTACACACACACACACACACACACACACACACACACACACACAC
AG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 98295534..98295854 319
NO GENE  


Sequence tag IST14471G2HMF1
Sequence
ATATGAAGTCTGAACTGAACATCCTTTTGAGGCCAGCCAGGGCTTCAGTATTAGAAATGGGCTACATATATAGTTGAGCT
GTTGGCTAAGGTGGTCCCTTGGAGATCCTTAAACAATCCATGCTGATGCTGGGACAAAACTGCTCTCACATAACTGACAG
CAGGGCCCCATCAATCAGGACAAATTCTACAAGGTTCACTGAATGTAGAAACCAAACTGGTGCAGGCTTGGAGCTTTCAC
CCCTATGTTCTATTCTCTTTGAAGAGAGAAGGAATTCTACACACACACACACACACACACACACACACACACACACACNC
T
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 98295534..98295851 318
NO GENE  

 
Come back to gene ENSMUSG00000074887


For any suggestions or comments, please send an email to unitrap@crg.es