Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14396E3
Clone ID IST14396E3
Vector VICTR74
Project tigm

Sequence tag IST14396E3BBF1
Sequence
GGAACAACCCACAGTACTTTGTATCACCCATCTGGGTGTGCAGGCTAGCATGTACCTGTGTAAGACTCCAGGGAGCCTTA
GCTTACTGGGGACTCTCTGAGTGACAATGTAGAGGCAGGATCGATGCAAAAAGCAAGAGGAATTTATTGTTCCGGTGCAC
TGGGGTCCTTCCCAGACTCAAAGGACAGGCGGCAACCCCCAGCACTCTGTCGGTGAGTTTTTATATGGTTTCCAGGGGCA
GAACAGGGCATCAGCAACTAGGCACAATATGATTGGCAGCACAGTACACCCTTTAAACTGGTCTTTAGCAAATGAGGTGA
CAAGGACTTCCCTTGTCAGAAGGTGCGCAACGTTCAGTCCTGCGGAATGTGTCCCCACCCGCAGGTCGGTTCCCTCCCTG
TGGTCTGANGAATGTNAATTANCNTCTCCCTTCCNGANNGGCNNNGGTTTCATGACCTTCCCAANNTTNCNGANCTGACC
TTTTCANNNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 154856523..154857008 456
NO GENE  


Sequence tag IST14396E3HMR1
Sequence
CCCCGAAGTGGCCTCGCTCCCCCGGCGAGATGGTGAGTGCTCCGGCCGGCGCCGCGGACACACAGACACGCACTCACACG
CACACTCGGACCCACGCACACGCGGCGGGCCCCGCGCCCACCGCCGCTTTCGCCTTCTGCACTCGGCGCGTCTGATTTTA
TTTCATGCTTCCTCGATTTCAATTTGCCGGGCCAGGCTTCCCCTGTCCCGGGAGAGCCAGCCTATCCNGGCTGGAGCTTT
CCGGAGTTCCGTGTCNNCNACTGGGCGGAGTAGGGTN
Sequence Type genomic DNA
Unitrap ID UNI33898

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 91566007..91566282 268
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031665 (Sall1) NM_021390 sal-like 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1889585]


Sequence tag IST14396E3HMF1
Sequence
GGAACAACCCACAGTACTTTGTATCACCCATCTGGGTGTGCAGGCTAGCATGTACCTGTGTAAGACTCCAGGGAGCCTTA
GCTTACTGGGGACTCTCTGAGTGACAATGTAGAGGCAGGATCGATGCAAAAAGCAAGAGGAATTTATTGTTCCGGTGCAC
TGGGGTCCTTCCCAGACTCAAAGGACAGGCGGCAACCCCCAGCACTCTGTCGGTGAGTTTTTATATGGTTTCCAGGGGCA
GAACAGGGCATCAGCAACTAGGCACAATATGATTGGCAGCACAGTACACCCTTTAAACTGGTCTTTANCAAATGAGGTGA
CAAGGACTTCCCTTGTCANANGGTGCGCAACGTTCANTCCTGCGGAATGTGTCCCCACCCGCANGTCGGTTCCCTCNNTG
TNNTCNNAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 154856608..154857008 387
NO GENE  

 
Come back to gene ENSMUSG00000031665


For any suggestions or comments, please send an email to unitrap@crg.es