Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13751H10
Clone ID IST13751H10
Vector VICTR74
Project tigm

Sequence tag IST13751H10BBF1
Sequence
AAAACAAACAAAAACAGTCACCAAAAGGACCCCGAAAAANCCAATGTGTTGCCAAAACTAAATCAAGAGTTTTCTATTAT
AAGCTCCTCCTGGATGTTTTCATTTTCATTCACTGGCCAGAACTGGCTCTCTGGCCACCGTGGGCTGCATGGCTGTCCCC
ACCTTGCTTTTGGATCT
Sequence Type genomic DNA
Unitrap ID UNI30826

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104149776..104149951 172
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018411 (Mapt) NM_001038609 microtubule-associated protein tau Gene [Source:MGI (curated);Acc:Mapt-003]


Sequence tag IST13751H10HMF1
Sequence
AAAACAAACAAAAACAGTNACCAAAAGGACCCCGAANAANCCAATGTGTTGCCAAAACTAAATCAAGAGTTTTCTATTAT
AAGCTCCTCCTGGATGTTTTCATTTTCATTCACTGGCCAGC
Sequence Type genomic DNA
Unitrap ID UNI30826

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104149776..104149895 114
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018411 (Mapt) NM_001038609 microtubule-associated protein tau Gene [Source:MGI (curated);Acc:Mapt-003]

 
Come back to gene ENSMUSG00000018411


For any suggestions or comments, please send an email to unitrap@crg.es