Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14784B4
Clone ID IST14784B4
Vector VICTR76
Project tigm

Sequence tag IST14784B4BBF1
Sequence
CTTAAACATCCTTCCAAATGCTTCTGATCACTTAACATGGCCTCACCTCCTCAACCACTCAGCTTCTCCAGGGTAAGGAA
AAAAATTAACATGGATTCCAGCATTTCCCAATATTGTCTCAGTCCTCTTGAGTTAATCCAGTCTGTTGATTTCCTAAGCT
AAACTGTCTGCTTGTGCAGATACCACTAACCACTAAATTCAATTCCTCGCTTCTTATAAGAACCATAATGTTTTCATGAA
TTTAACTGTTCAGACTAAGGATTCTCTGTAATAAAATAAAATGTAATCACGTTTTAAAAAATGAAATTGTAGTTTAATGA
GGCTTTTTTATAGTAAAGATATATGGAGACCTTGTGTTCCTTTTATTNATTGTTTGTTTTTGAGACAATGTCTCACATAG
CTCANGCTGACTTCAAACTTCTCTTTCTTTGCNNGTTTCCNAAGTGCTGGGATTATAGGCATGTACNACCNNATCNGGCT
CTCCNTANNNGNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 80445125..80445611 467
 
EST/CDNA Est Name
  BG862262.1 - CF730761.1 - BF140375.1 - CF159884.1 - AA154046.1 - AI892929.1 - CD805991.1 - AW909636.1 - CF750571.1 - BI112536.1 - BQ933680.1 - CK333405.1 - CD807434.1 - CD771734.1 - CF894466.1 - CN666524.1


Sequence tag IST14784B4HMR1
Sequence
TTAGTACTAAGTATAAGGTTTTAAATACGTTAGAATGGGAGTGGAAGATCAGTTCCTATTTGGTGTAAAAAATGATTTTC
TTGAAACTTAGGTTATCTGTAAATGTGAAGAAAGATAGTGAATGCCTTATTGCTGGTATTGGTTAGGCAGT
Sequence Type genomic DNA
Unitrap ID UNI33904

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 80444978..80445126 149
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024095 (AC122253.5) NP_659051 Heterogeneous nuclear ribonucleoprotein L-like [Source:UniProtKB/Swiss-Prot;Acc:Q921F4]

 
Come back to gene ENSMUSG00000024095


For any suggestions or comments, please send an email to unitrap@crg.es